Поиск

Полнотекстовый поиск:
Где искать:
везде
только в названии
только в тексте
Выводить:
описание
слова в тексте
только заголовок

Рекомендуем ознакомиться

'Доклад'
Искусство это, прежде всего воспитание души, чувств, уважение к духовным ценностям. Оно не только отражает жизнь, но и формирует ее, создает представ...полностью>>
'Регламент'
АДМИНИСТРАТИВНЫЙ РЕГЛАМЕНТИСПОЛНЕНИЯ ФЕДЕРАЛЬНОЙ СЛУЖБОЙ ФИНАНСОВО-БЮДЖЕТНОГОНАДЗОРА ГОСУДАРСТВЕННОЙ ФУНКЦИИ ПО ОСУЩЕСТВЛЕНИЮ КОНТРОЛЯИ НАДЗОРА ЗА СО...полностью>>
'Методические рекомендации'
Осознание касающихся любого гражданина России проблем глобальной безопасности и национальных про­блем, изменившихся в новых условиях и обозначенных в...полностью>>
'Руководство'
Как выяснилось из моей недавней беседы с руководством, некоторые мною созданные последовательности склеенных между собой кадров не соответствуют конц...полностью>>

Baicalia

Главная > Автореферат диссертации
Сохрани ссылку в одной из сетей:

На правах рукописи

УДК 597.08.575.1

ПЕРЕТОЛЧИНА ТАТЬЯНА ЕВГЕНЬЕВНА

МИКРОЭВОЛЮЦИОННЫЕ ПРОЦЕССЫ В ГРУППЕ ВИДОВ БАЙКАЛЬСКИХ ЭНДЕМИЧНЫХ ГАСТРОПОД РОДА BAICALIA (MOLLUSCA, CAENOGASTROPODA)

03.00.15 – генетика

Автореферат

диссертации на соискание ученой степени

кандидата биологических наук

Новосибирск

2008

ПЕРЕТОЛЧИНА ТАТЬЯНА ЕВГЕНЬЕВНА

Работа выполнена в лаборатории геносистематики Лимнологического института СО РАН.

Научный руководитель: доктор биологических наук

Д.Ю. Щербаков

Лимнологический институт СО РАН, г. Иркутск

Официальные оппоненты: доктор биологических наук

проф. П.М. Бородин Институт цитологии и генетики СО РАН, г. Новосибирск

кандидат биологических наук Н. Л. Белькова

Лимнологический институт СО РАН, г. Иркутск

Ведущее учреждение: Институт систематики и

экологии животных СО РАН, г. Новосибирск

Защита состоится: «_12_»__марта__2008 г. на утреннем заседании диссертационного совета Д-003.011.01 в Институте цитологии и генетики СО РАН в конференц-зале Института по адресу: 630090, г. Новосибирск, проспект Лаврентьева, 10, тел. (383) 333 1278, e-mail: dissov@

С диссертацией можно ознакомиться в библиотеке Института цитологии и генетики СО РАН.

Автореферат разослан «____» ____________2008г.

Ученый секретарь

диссертационного совета,

доктор биологических наук А.Д. Груздев

ВВЕДЕНИЕ

Актуальность работы. Методы молекулярной биологии и популяционной генетики, включающие сравнительный анализ гомологичных нуклеотидных последовательностей уже более десяти лет применяют для исследования внутривидового полиморфизма. В настоящее время достаточно мало известно о механизмах видообразования и репродуктивной изоляции, несмотря на простоту оценки внутри- и межпопуляционного полиморфизма на молекулярном уровне (Avise, 1994). При использовании филогенетических подходов для анализа генетического полиморфизма популяций появилась возможность изучения их эволюционных историй (Vigilant et al., 1991). Относительная легкость определения нуклеотидных последовательностей ДНК дала возможность отдельно анализировать синонимический и несинонимический полиморфизм, и, таким образом, изучать как адаптивную, так и неадаптивную эволюцию на молекулярном уровне. В качестве объекта исследования выбрали группу эндемичных видов моллюсков рода Baicalia Martens, 1876 из сем. Baicaliidae. Биологическая и экологическая изученность этих моллюсков, а также их широкое распространение и низкая скорость перемещения по периметру водоема, дают уникальную возможность для изучения сценариев видообразования в оз. Байкал.

В Байкале к настоящему времени обнаружено 179 видов моллюсков, из которых 41 принадлежат эндемичному семейству Baicaliidae (Sitnikova, 1994). На протяжении более чем столетней истории изучения байкальских моллюсков их таксономия неоднократно пересматривалась. Современная классификация построена на таких морфологических признаках, как – особенности строения раковины и радулы и анатомии женской половой системы (Dybowski, 1875; Lindholm, 1909, 1924; Кожов, 1951; Ситникова, 1991). Для семейства Baicaliidae характерно большое разнообразие форм и скульптуры раковин, многим видам свойственна высокая степень морфологического внутривидового полиморфизма (Кожов, 1936). Большой размах внутривидовой изменчивости серьезно затрудняет и видовую идентификацию, и, следовательно, систематику этой группы. Сравнение нуклеотидных последовательностей митохондриального гена, кодирующего первую субъединицу цитохром оксидазы, свидетельствует об исключительно быстром процессе видообразования при адаптивной радиации от общего предка, существовавшего, предположительно, 3,0-3,5 млн. лет назад (Зубаков и др., 1997; Щербаков, 2003).

Наличие множества переходных форм особенно ярко выражено у представителей рода Baicalia. Из всех видов этого рода наиболее изменчивым оказался вид Baicalia carinata W. Dyb., 1875, который, в то же время, является одним из наиболее широко распространенных в озере (Кожов, 1936). Представители этого вида обитают как в открытых частях Байкала, так и в бухтах на глубинах от 5 до 100 м и населяют песчаные или песчано-илистые грунты. Самки этого вида откладывают яйца на раковины других моллюсков своего вида.

В 1914 году Ж. Грохмалицкий и Б. Дыбовский (Dybowski, Grochmalicki, 1914) описали 10 внутривидовых форм B. carinata. М.М. Кожов (Кожов, 1936) считал выделенные предыдущими авторами вариететы экологическими формами одного вида. Только для одной из форм, отличающейся от других наличием слабо выраженных поперечных складок на раковине, М.М. Кожов предложил сохранить подвидовое название Baicalia carinata rugosa, данное В.А. Линдгольмом (Lindholm, 1909).

Описанные выше особенности каринат делают их исключительно интересным объектом исследования микроэволюционных процессов. В этом качестве каринаты обладают рядом преимуществ даже по сравнению с цихловыми рыбами Великих африканских озер, которые относятся к наиболее популярным объектам для исследования моделей микроэволюции. Каринаты также принадлежат к букету видов (Brooks, 1950), населяют почти непрерывную зону по периметру озера Байкал, образуя систему популяций, которые в первом приближении можно считать одномерными, но, в отличие от рыб, моллюски никогда не отрываются от дна, что очень сильно ограничивает их латеральную относительно шельфа миграцию.

Цель и задачи исследования:

Цель настоящего исследования состояла в изучении генетической дифференциации видов рода Baicalia по периметру оз. Байкал и анализе микроэволюционных процессов, обеспечивающих высокое видовое разнообразие байкалий. Согласно поставленной цели были сформулированы следующие задачи:

1) Исследование генетического полиморфизма видов рода Baicalia по фрагментам митохондриальных и ядерных ДНК.

2) Установление филогенетических взаимоотношений вида Bcarinata с другими видами рода Baicalia по результатам сравнения последовательностей митохондриального гена СО1 и ядерного спейсера – ITS1.

3) Определение пространственно-генетической неоднородности в рамках вида Baicalia carinata в зависимости от районов озера.

4) Сравнение характера молекулярной эволюции у сестринских видов рода Baicalia по митохондриальному и ядерному молекулярным маркерам.

5) Сравнение морфологической и генетической изменчивости Bcarinata.

Научная новизна. Впервые в результате проведенной работы с помощью методов молекулярного анализа подробно исследована пространственно-генетическая неоднородность эндемичного байкальского вида Bcarinata. Установлено подразделение вида как минимум на две популяции: Юго-Западную и Восточную.

Использование рангового критерия Манна и Уитни подтвердило статистическую достоверность различий между выделенными популяциями по молекулярно-генетическим данным.

Исследованы филогенетические взаимоотношения внутри рода Baicalia. Установлено, что B. carinata является предковым видом по отношению к остальным видам этого рода.

Проведено сравнение характера молекулярной эволюции у сестринских видов рода Baicalia по митохондриальному и ядерному молекулярным маркерам. Выявлено различие по скоростям накопления замен между сестринскими видами в митохондриальной ДНК.

Практическое значение работы. Полученные результаты могут быть использованы для моделирования макро- и микроэволюционных процессов формирования репродуктивной изоляции и видового разнообразия. Наработанные данные могут помочь в развитии общей теории видообразования эндемичных брюхоногих моллюсков озера Байкал.

Нуклеотидные последовательности фрагмента гена СО1 мтДНК депонирована в GenBank с номерами доступа: DQ436347-DQ436441.

Материалы диссертационной работы должны быть привлечены при проведении таксономической ревизии семейства Baicaliidae.

Результаты проведенных исследований используют в курсе лекций по генетике на биолого-почвенном факультете Иркутского Государственного Университета.

Апробация работы и публикации. Материалы диссертации докладывались на Международной конференции «Molluscs of the Northeastern Asia and Northern Pacific: Biodiversity, Ecology, Biogeography and Faunal History». Владивосток, 2004. На Четвертой Верещагинской Байкальской конференции. Иркутск, 2005. На пятой международной конференции «International conference on Bioinformatics of Genome regulation and Structure». Новосибирск, 2006. На всероссийской научной конференции «Структура и экспрессия митохондриального генома растений». Иркутск, 2006. На четвертой международной конференции «Speciation in Ancient Lakes, SIAL IV» Берлин, Германия, 2006. На Международном Малакологическом Конгрессе, Антверпен, Бельгия, 2007.

По материалам диссертации опубликовано 10 работ из них 3 в рецензируемых журналах.

Структура и объем диссертации. Работа включает следующие разделы: введение, литературный обзор, материалы и методы, результаты и обсуждение, заключение, выводы и список используемой литературы (181 источник). Диссертация изложена на 118 страницах, содержит 39 рисунков и 6 таблиц.

МАТЕРИАЛЫ И МЕТОДЫ

Сбор моллюсков осуществляли с помощью драги и водолазами с глубины 10-40 метров в 30 районах Байкала (табл. 1) во время летних экспедиций 2003-2006 гг. Сразу после разбора бентосной пробы моллюсков фиксировали 80% этиловым спиртом, через сутки меняли фиксатор на 70% спирт.

Таблица 1. Районы сбора и количество расшифрованных нуклеотидных последовательностей по фрагментам CO1 и ITS1.

Место сбора

Фрагмент гена СО1

Фрагмент ITS1

Пос. Большие Коты

4

-

Бухта Варначка

4

4

Бухта Песчаная

9

2

Малое море, залив Тутайский

7

-

М. Боро-Елга

-

5

Пролив Ольхонские Ворота

16

6

Малое море, губа Семисосенная

7

4

М. Крест

6

4

М. Арал

1

-

Губа Большая Коса

2

-

Губа Богучанская

2

3

Середина о. Ярки

5

6

Губа Дагарская

3

1

Губа Аяя

2

3

М. Понгонье

6

7

Губа Иринда

2

6

Губа Якшакан

3

6

Бухта Сорожья

4

2

Чивыркуйский залив, напротив р. Большой Чивыркуй

5

5

Чивыркуйский залив, напротив р. Малая Сухая

2

3

В р-не о. Лиственичный

3

9

М. Тонкий

4

4

Между м. Тонкий и м. Туркинский

3

3

Губа Таланка

3

9

Около бухты Гремячинск

7

-

Около пос. Танхой

4

-

Муринская Банка

7

3

Около пос. Утулик

3

5

Около пос. Култук

1

2

М. Половинный

4

4

Около г. Байкальск

-

3

Всего

129

109

Экстракция ДНК. ДНК экстрагировали по модифицированному методу Дойла и Диксона (Doyle J.J., Dickson E., 1987) или методу Соколова (Sokolov E.P., 2000).

Амплификация ДНК. Амплификация фрагмента гена СО1 производилась методом ПЦР с использованием пары универсальных для беспозвоночных праймеров, фланкирующих фрагмент ДНК размером 710 п.н. (Folmer, 1994) и имеющих следующую структуру: L1490: 5′ - GGTCAACAAATCATAAAGATATTGG - 3′;

H3198: 5′ - TAAACTTCAGGGTGACCAAAAAATCA - 3′

Амплификацию фрагмента ITS1 проводили методом ПЦР, при помощи праймеров КР-2 (Salim and Maden, 1981) и 5,8S (Nazar and Roy, 1978), имеющих следующую структуру: ITS1 KP-2: 5′ - AAAAAGCTTCCGTAGGTGAACCTGCG - 3′;

ITS1 5,8S: 3′ - AGCTTGGTGCGTTCTTCATCGA - 3′

Определение нуклеотидных последовательностей. Прямое секвенирование двухцепочечных продуктов амплификации проводилось на автоматическом секвенаторе модели 373А фирмы “Applied Biosystem Inc.” с набором реактивов “Thermo Sequenase II dye terminator cycle sequencing kit” фирмы “Amersham pharmacia biotech”, а также на автоматическом секвенаторе CEQ 8800 (Beckman Coulter Inc.) с набором реактивов “Dye Terminator Cycle Sequencing with Quick Start Kit” фирмы “Beckman Coulter”, при помощи тех же праймеров (L1490 и H3198; Кр-2 и 5,8S).

Морфометрия. Все раковины моллюсков в рамках каждого сбора были измерены и сфотографированы, на основе чего создана компьютерная база данных. Промеры проводили с помощью бинокуляра, и только в случае очень крупных раковин использовали штанген-циркуль. Раковины измеряли по стандартной схеме (Жадин, 1952), дополненной измерениями ширины и высоты каждого из пяти оборотов, расположенных над устьем. Для статистического анализа данных использовали программы Excel и Statistica 6.0. Для оценки степени дивергенции между группами Bcarinata вычисляли коэффициент Майра, определяемый как разность средних значений признаков в сравниваемых популяциях, деленная на сумму среднеквадратических отклонений (Майр, 1971).

Компьютерная обработка данных. Выравнивание нуклеотидных последовательностей СО1 и ITS1 проводилось с помощью программы BioEdit (Hall, 1999). Генетические расстояния между нуклеотидными последовательностями оценивали с помощью двухпараметрической модели Кимуры (Kimura, 1980) для чего использовали программу DNADist из пакета программ Phylip (Felsenstein, 1996). Филогенетические древа строили методом максимального правдоподобия (Maximum Likelihood, ML) (Felsenstein, 1981) с помощью программы Phyml (Bevan, et al 2005) и баесовским методом, программой MrBayes (Ronquist, Huelsenbeck, 2003). Популяционные параметры θ0 и g вычисляли с помощью программы FLUCTUATE из пакета программ LAMARC (Kuhner et al., 1995). θ0 - характеризует размер популяции и описывается формулой θ0=4Neμ, где Ne – эффективная численность популяции, μ - скорость накопления мутаций на сайт за поколение. Скорость изменения θ описывается выражением dθ/dt= θ0egt Параметр g (growth) характеризует изменение численности популяции и определяется как g=[t-1].

Для изучения популяционной структуры строили простирающиеся древа методом максимальной экономии (Maximum Parsimony, MP) с помощью программы NetWork (Bandelt et al., 1995; Bandelt et al., 1999).

Для оценки достоверности генетических отличий между выделенными нами популяциями использовали критерий Манна и Уитни.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ



Скачать документ

Похожие документы:

  1. Ment and Capital Standards: a Revised Framework, or Basel II framework, сокращенный перевод которого представлен в приложении к данной информации Банка России

    Документ
    Департамент внешних и общественных связей Банка России сообщает, что 26 июня 2004 года опубликован утвержденный Базельским комитетом по банковскому надзору (далее — Комитет) и одобренный руководителями центральных банков и главами
  2. The Picture of Dorian Gray

    Документ
    The highest as the lowest form of criticism is a mode of autobiography. Those who find ugly meanings in beautiful things are corrupt without being charming.
  3. Затверджено Постановою Кабінету Міністрів України від №

    Документ
    Для створення умов безпечного обігу хімічних речовин на ринку України в умовах вступу України до СОТ та дії зони вільної торгівлі Україна-Євросоюз розроблено Порядок реєстрації, оцінки та визначення умов розміщення на ринку України
  4. Паразитологии и экологии

    Библиографический указатель
    Вопросы паразитологии и экологии гидробионтов: Библиографический указатель научных трудов Н.М. Пронина / РАН. Сиб. отд-ние. Ин-т общей и экспериментальной биологии; Сост.
  5. C i T Á c I e p u b L i K O V A N Ý c h p r á C

    Документ
    ADCA KAČMARČÍK, Jozef - PRIBULOVÁ, Zuzana - SAMUELY, Peter - MARCENAT, C. - KLEIN, T. - JANG, D.J. - LEE, H.G. - LEE, H.S. - LEE, S.I. AC Microcalorimetry of Superconducting MgCNi3 Single Crystals.

Другие похожие документы..